Skip to main content

Table 1 Oligonucleotides used for plasmids construction and Real Time PCR study

From: Functional analysis of Paracoccidioides brasiliensis 14-3-3 adhesin expressed in Saccharomyces cerevisiae

Name Description (5′–3′)
14-3-3F CGGGATCCATGGGTTACGAAGATG
14-3-3R CCGCTCGAGCTACTCAGCGGCCTTAGG
BMH1F CG GGATCC ATGTCAACCAGTCGTGAAG
BMH1R CG GAATTC TTACTTTGGTGCTTCACC
ERG1F ATCCATTGACTGGTGGTGGT
ERG1R CGGTCGCTGAAGTCTAGGTC
ERG11F CCTCTTATTCCGTCGGTGAA
ERG11R TGTGTCTACCACCACCGAAA
ERG28F CAACCCATTTGAGTGCAAGA
ERG28R GAAGTGGAATAGGGCAACCA
HES1F TGTGGCAGAAGCAATCAGAC
HES1R CTTTGCCATTCCACACCTTT
ACT1F CGGTGATGGTGTTACTCACG
ACT1R GGCCAAATCGATTCTCAAAA