Skip to main content

Table 1 PCR primers used in qRT- PCR gene expression assays

From: Salmonella grows vigorously on seafood and expresses its virulence and stress genes at different temperature exposure

Gene Product size (bp) Sequence (5’-3’)
fimA 92 TGTGCCGTCAGCACTAAATCTGGTGTTATCTGCCTGACCA
invA 268 GTGAAATTATCGCCACGTTCGGGCAATCATCGCACCGTCAAAGGAACC
Stn 181 TGTGCCGTCAGCACTAAATCTGGTGTTATCTGCCTGACCA
rpoE 165 GGTAGTTCTTCGCGGTATTGACATAAAGTGGCGAGTCTGGTTTC
gapdh 215 ACCGTTGAAATCGGTAGATACAATAGGTAAAGTACTGCCGGAACTG