Skip to main content

Table 1 Selected primers with target regions and experimental setup

From: Quinolone resistance mutations in the faecal microbiota of Swedish travellers to India

Gene Target region Product size Forward primer Reverse primer Annealing T
gyrA 129–439 311 bp ggtacaccgtcgcgtacttt caacgaaatcgaccgtctct 57 °C
parC 20–306 287 bp gccttgcgctacatgaattt accatcaaccagcggataac 57 °C