Skip to main content

Table 7 List of primers for detection of genes belongs to pln locus and LPs shyntetase

From: Microbial inoculants for the biocontrol of Fusarium spp. in durum wheat

Target gene Primers Annealing temperature (°C) References
plnE/F fw: 5′- GGCATAGTTAAAATTCCCCCC-3′ 53.2 Doulgeraki et al., 2013 [37]
rev: 5′- CAGGTTGCCGCAAAAAAAG-3′
plnJ fw: 5′-TAACGACGGATTGCTCTG-3′ 51 Doulgeraki et al., 2013 [37]
rev: 5′- AATCAAGAAATTATCACATTAGTC-3′
plnK fw: 5- CTGTAAGCATTGCTAACCAATC 52.9 Doulgeraki et al., 2013 [37]
rev: 5- ACTGCTGACGCTGAAAAG
plnG fw: 5- TGCGGTTATCAGTATGTCAAAG 52.8 Doulgeraki et al., 2013 [37]
rev: 5-CCTCGAAACAATTTCCCCC
plnN fw: 5- ATTGCCGGGTTAGGTATCG 51.9 Doulgeraki et al., 2013 [37]
rev: 5- CCTAAACCATGCCATGCAC
Surfactin synthetase As1-f CGCGGMTACCGVATYGAGC 43 °C Tapi et al., 2010 [38]
Ts2-r ATBCCTTTBTWDGAATGTCCGCC
Fengycin synthetase Af2-f GAATAYMTCGGMCGTMTKGA 45 °C Tapi et al., 2010 [38]
Tf1-r GCTTTWADKGAATSBCCGCC
Mycosubtilins syntetase Am1-f CAKCARGTSAAAATYCGMGG 45 °C Tapi et al., 2010 [38]
Tm1-r CCDASATCAAARAADTTATC
Iturin A synthetase ituC-f AAAGGATCCAAGCGTGCCTTTTACGGGAAA 56 °C Alvarez et al. 2011 [39]
ituC-r AAAAAGCTTAATGACGCCAGCTTTCTCTT