Skip to main content

Table 1 Characteristics of primers used for PCR amplification of genus specific genes and virulence genes

From: Antimicrobial resistance and virulence signatures of Listeria and Aeromonas species recovered from treated wastewater effluent and receiving surface water in Durban, South Africa

Organism Primer Sequence (5′–3′) Product size (bp) References
Listeria monocytogenes Plc A CTG CTT GAG CGT TCA TGT CTC ATC CCC C 1484 [35]
   ATG GGT TTC ACT CTC CTT CTA C
  Act A CGC CGC GGA AAT TAA AAA AAG A 839
   ACG AAG GAA CCG GGC TGC TAG
  Iap ACA AGC TGC ACC TGT TGC AG 131
   TGA CAG CGT GTG TAG TAG CA
Aeromonas spp. aer-F CCTATGGCCTGAGCGAGAAG 431 [36]
aer-R CCAGTTCCAGTCCCACCACT
  lip-F CA(C/T)CTGGT(T/G)CCGCTCAAG 247  
  lip-R GT(A/G)CCGAACCAGTCGGAGAA   
Listeria spp. List-Universal 1 ATGTCATGGAATAA 457–610 [28]
  List-Universal 2 GCTTTTCCAAGGTGTTTTT   
Aeromonas spp. gyrB3F TCCGGCGGTCTGCACGGCGT 1100 [29]
gyrB14R TTGTCCGGGTTGTACTCGTC
\