Skip to main content

Table 6 qRT-PCR primers

From: Changes in global gene expression of Vibrio parahaemolyticus induced by cold- and heat-stress

Gene ID Sequence 5′ to 3′ Size [bp] Reference
1623S bp 134385 GCTGACAAAACAACAATTTATTGTT 170 [45]
to 135166a GGAGTTTCGAGTTGATGAAC
groES VP2852 TATTCAACGATCGCCATGAT 108 This study
TGGTGACACCGTTATCTTCG
cspA VPA1289 TATCGTTGCTGACGGTTTCA 90 This study
TCAGTCGCTTGAGGACCTTT
pvsA VPA1658 GGACCTCCACGTCGTTCTTA 112 This study
GGGATTGAAGACATCGCACT
pvuA VPA1656 GCTGTCGATGCTTGATCGTA 107 This study
GTGGAATCGGTTTGGTCACT
recA VP2550 GAAACCATTTCAACGGGTTC 139 [25]
GTGCAGCAGCGATAAGCTC This study
dnaE VP2303 GATTACCGCTTTCGCCG 140 [25]
GTGTATCCATGCCCGATTTC This study
dtdS VPA1508 TGGCCATAACGACATTCTGA 124 [25]
TTCGTGACCGACAACCATAG This study
pyrC VPA0408 AGCAACCGGTAAAATTGTCG 142 [ 25 ]
TCCATGAACCAAAAGCAACA This study
tnaA VPA0192 TGTACGAAATTGCCACCAAA 103 [25]
TCAGCGTAACCTTCTTCACG This study
  1. a 16S-23S intergenic spacer region encoded on chromosome 2