Skip to main content

Table 2 Genes and primers used for Multilocus sequence typing

From: Multilocus sequence typing of Streptococcus thermophilus from naturally fermented dairy foods in China and Mongolia

Gene Amplicon size (bp) Application size (bp) Gene function PCR primer Sequences (5’-3’) Temperature
carB 652 499 carBamoyl phosphate synthetase carB_primerF AAGGCTACAGTGTTGTTCT 51 °C
    carB_primerR GATAAGGTTTGCGTTGG  
clpX 768 630 ATP-dependent Clp protease subunit X clpX_primerF GCAGGTTATGTGGGTGA 52 °C
    clpX_primerR TACTGGAGCAGCTTTCC  
dnaA 669 522 chromosomal replication initiator protein dnaA dnaA_primerF CACCAGGAGCAACTTAT 49 °C
    dnaA_primerR CTTCAATCGGAATGAGA  
murC 592 451 UDP-N-acetyl muramate-alanine ligase murC_primerF TTTGTTTACGGTGAGGA 51 °C
    murC_primerR CCACTTTGGCAGGTTTA  
murE 721 592 UDP-N-acetylmuramyl tripeptide synthase murE_primerF AACACCCTCAAGACAAA 48 °C
    murE_primerR ACGAATACCTTAGCACC  
pepN 737 615 lysyl-aminopeptidase, aminopeptidase N pepN_primerF CGCTGAAGAGGGCGATAC 58 °C
    pepN_primerR CTAACCAACGGCGGAGC  
pepX 664 524 X-prolyl dipeptidyl aminopeptidase pepX_primerF ACATCCCTGTTAGTCCTG 52 °C
    pepX_primerR TCTCCCTCCATCTTGTG  
pyrG 736 624 CTP synthase pyrG_primerF CACTGAAGTTGGTGGGA 52 °C
    pyrG_primerR CATACCGAGGCAGACAC  
recA 768 617 recombinase A recA_primerF AAAGAAGGTGGCATCGC 58 °C
     recA_primerR ATCGTCCTCATCTAGCTCAAC  
rpoB 786 661 RNA polymerase beta subunit rpoB_primerF CATTACACGCACTACGG 47 °C
     rpoB_primerR GATAACAGCATCCTCGA