Skip to main content

Table 1 Oligonucleotides used in this study

From: Evidence for the involvement of cofilin in Aspergillus fumigatus internalization into type II alveolar epithelial cells

Name Sequence
rod-upS GACTAGTGCACGAGGAGGCTTCTTATT
rod-upA GAGCTCCAGCTTTTGTTCCTCACGGTGATGTCGTCAGG
rod-dwS AAGCTTATCGATACCGTCGACGGTTCCCTCATTGGACTGG
rod-dwA CCGCTCGAGGCAACAACATCAGCACCCT
hph-rodS CCTGACGACATCACCGTGAGGAACAAAAGCTGGAGCTC
hph-rodA CCAGTCCAATGAGGGAACCGTCGACGGTATCGATAAGCTT
rod-yS GGCTGCGAGATTGCGATAA
rod-yA CGATATTTGGACGCCCTAC
rod-rodS GCTGCTGGCAATGGTGTT
rod-rodA CCGCTCTGATGGACGTTAGT