Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in the heptaplex PCR assay

From: Development of a heptaplex PCR assay for identification of Staphylococcus aureus and CoNS with simultaneous detection of virulence and antibiotic resistance genes

Target DNA Amplicon size (bp) Primer Identity Primer sequence 5’ → 3’ Reference
cns 204 cns-1 TATCCACGAAACTTCTAAAACAACTGTTACT [27]
cns-2 TCTTTAGATAATACGTATACTTCAGCTTTGAATTT
16S rRNA 174 16S-1 CTAGTAATCGCGGATCAGCAT [27]
16S-2 GATACGGCTACCTTGTTACGACTT
mecA 155 mecA-1 TGGTATGTGGAAGTTAGATTGGGAT [26]
mecA-2 CTAATCTCATATGTGTTCCTGTATTGGC
tuf 143 tuf-1 TACCAGCATTAGTAGTATTCTTAAACAAAGTTG This study
tuf-2 TGCTGAACCAGCGATTACAG
pvl 118 pvl-1 TTACACAGTTAAATATGAAGTGAACTGGA [26]
pvl-2 AGCAAAAGCAATGCAATTGATG
vanA 111 vanA-1 GCTGTGAGGTCGGTTGTG This study
vanA-2 GCTCGACTTCCTGATGAATACG
spa 101 spa-1 CAGCAAACCATGCAGATGCTA [26]
spa-2 CGCTAATGATAATCCACCAAATACA