Skip to main content

Table 2 Primer pairs designed for amplifying tufB, groEL and inmp gene nucleotide sequences in direct (d) and nested (n) PCR reactions

From: Candidatus Phytoplasma phoenicium’ associated with almond witches’-broom disease: from draft genome to genetic diversity among strain populations

Gene Primer Sequence (5′-3′) Amplicon size (nt)
tufB fusAF1 (d) ATCGTGGTAATGCGATTGTGG 1431
  tufBR1 (d) ACAGAACCAGCTCCAACAGTACGTCC  
  fusAF2 (n) TGGTTATGCAACCACTTTACGTTC 1320
  tufBR2 (n) TAGTGCAATAGGATGAATTAAAGTCAC  
groEL groELF1 (d) TGATAATGCAGGCGACGGAACTAC 1336
  groELR1 (d) TCACAGCCACTACGGCAGCACCAGCTG  
  groELF2 (n) ACTACTACAGCTACTGTATTAGCAC 1284
  groELR2 (n) TAGATGCTGCAATAGAAGAAGCATTG  
inmp inmpF1 (d) AGTAATTAATTTTCAATATTGGACTG 668
  inmpR1 (d) TCACATCATCCTCATTCATTTTTGAAGC  
  inmpF2 (n) AGAAATCTTATCAGTGGTATCAGTC 413
  inmpR2 (n) TCTTTATCTATTGTTTTATATGCCAC