Skip to main content

Table 1 Oligonucleotide primers used in this study

From: A ferritin-like protein with antioxidant activity in Ureaplasma urealyticum

Primer Sequence (5′ → 3′) Characteristic Function
Fer-F AAGGTATGCTTAGAAGAAGGTG   Real-time RT-PCR Evaluation of uuferritin
Fer-R TTGTACGAACATCATCAAAATC   
16S-F CAAGAATGAAACTCAAACGGAA   Real-time RT-PCR Evaluation of 16 s RNA (normalizer)
16S-R CAACCATGCACCACCTGTC   
F-1 GTACATATGCAAGAGAAACCCC NdeI To amplify gene uuferritin
R-1 ACGGATCCTTATTTCTTGGAATATGGAGC BamHI  
MF-1 TTTGTAGATGATGGTATTAAAGATT   To mutate gene uuferritin
MR-1 CCATTTAACGAAACTAAAAGTTCA   
  1. The underlined sequences are the restriction sites