Skip to main content

Table 3 Oligonucleotides used in this study to amplify the enterococci virulence genes

From: Virulence and antimicrobial resistance factors of Enterococcusspp. isolated from fecal samples from piggery farms in Eastern Cape, South Africa

Gene Virulence marker Oligonucleotide sequence(5' to 3') Product size (bp) Annealing temp(C) References
As Aggregation substance 1 CCAGTAATCAGTCCAGAAACAACC 406 54 25
   AS 2 TAGCTTTTTTCATTCTTGTGTTTGTT    
Ace Adhesion colaagen in E. faecalis ACE 1 AAAGTAGAATTAGATCCACAC 320 56 25
Gel Gelatinase gel E1 AGTTCATGTCTATTTTCTTCAC 402 56 25
   gel E2 CTTCATTATTTACACGTTTG    
EfaA E. faecalis antigen A efaA1 CGTGAGAAAGAAATGGAGGA 499 56 25
   efaA2 CTACTAACACGTCACGAATG    
Esp Surface protein Esp 46 TTACCAAGATGGTTCTGTAGGCAC 913 58 32
   Esp 47 CCAAGTATACTTAGCATCTTTTGG    
CylA Cytolisin Cyl I ACTCGGGGATTGATAGGC 688 56 32
   Cyl Iib GCTGCTAAAGCTGCGCTT    
Hyl Hyaluronidase Cyl Iib GCTGCTAAAGCTGCGCTT 276 56  
   Hyl n1 ACAGAAGAGCTGCAGGAAATG Hyl n2 GACTGACGTCCAAGTTTCCAA