Skip to main content

Table 1 List of primers and control strains

From: Virulence and antimicrobial resistance factors of Enterococcusspp. isolated from fecal samples from piggery farms in Eastern Cape, South Africa

Strain Primer Sequence 5'-3' Product size (bp) Ref
E. faecalis ATCC 19433 FL1 ACTTATGTGACTAACTTAACC 360 23
  FL2TAATGGTGAATCTTGGTTTGG   
E. durans ATCC 19432 DU1 CCTACTGATATTAAGACAGCG 295 23
  DU2 TAATCCTAAGATAGGTGTTTG   
E. casseliflavus ATCC 25788 CA1 TCCTGAATTAGGTGAAAAAAC 288 23
  CA2 GCTAGTTTACCGTCTTTAACG   
E. faecium ATCC19434 GAAAAAACAATAGAAGAATTAT 215 23
  FM2 TGCTTTTTTGAATTCTTCTTTA   
E. hirae ATCC 8043 HI1 CTTTCTGATATGGATGCTGTC 187 23
  HI2 TAAATTCTTCCTTAAATGTTG