Skip to main content

Table 1 Characteristics of each MLVA loci for S. Typhimurium

From: Characterization of Salmonella Typhimurium isolates from domestically acquired infections in Finland by phage typing, antimicrobial susceptibility testing, PFGE and MLVA

Locus Repeat length (bp) Reference strain (location) Primer sequence (3’ → 5’) Smallest product (bp) Largest product (bp) Gene
STTR3 27/33 LT2 (3629458) STTR3-F:NED-ccccctaagcccgataatgg 464 530 bigA
STTR3-R: tgacgccgttgctgaaggtaataa
STTR5 6 LT2 (3184543) STTR5-F:NED-atggcgaggcgagcagcagt 228 300 yohM
STTR5-R:ggtcaggccgaatagcaggat
STTR6 9 LT2 (2730867) STTR6-F:6FAM-tcgggcatgcgttgaaa 283 397 Prophage related
STTR6-R: ctggtggggagaatgactgg
STTR9 9 LT2 (3246672) STTR9-F:6FAMagaggcgctgcgattgacgata 163 181 Intergenic
STTR9-R: cattttccacagcggcagtttttc
STTR10p 6 pSLT (53711) STTR10-F: PETcgggcgcggctggagtatttg 358 496 In plasmid
STTR10-R: gaaggggccgggcagagacagc