Skip to main content

Table 1 Primers used in this study to investigate CTX-M-15 location

From: Molecular epidemiology and characterization of an outbreak causing Klebsiella pneumoniae clone carrying chromosomally located bla CTX-M-15 at a German University-Hospital

Name Nucleotide-Sequence (5’-3’)
DOW2.55 GCATCCAAGAGATTCTATCG
DOW2.5 CATACACTCCCTTGTACGG
MP4b-F TCCTCGACGTTCACGTCT
MP-3 F AGGGTGAAGCTCAGCTTG
ALA2b ATGGTTAAAAAATCACTGCG
ALA3b TTTGCGCATACAGCGGCACAC
P2BC CGCTGATTTAACAGATTCGG
PIAc GGCGATCCGCGTGATACCAC
P2Dc CAGCGCTTTTGCCGTCTAAG
MF-2 F TGACGATGACCGCTTTCT
MF-2R CGTCGACTACAGCTTTAA