Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: Regulation of the pstSCAB operon in Corynebacterium glutamicum by the regulator of acetate metabolism RamB

Oligonucleotide Sequence (5’ → 3’)
pstsRforward CCCCTCGAGTAAAAAAGAGACTTGCTAAAAACCT (XhoI)
pstsR0forward CCCCTCGAGTAAGAATCGGTGATTTTCGTTCC (XhoI)
pstsR1forward CCCCTCGAGAGAGTCTCCAAATGTTACGAGTGAA (XhoI)
pstsR2forward CCCCTCGAGCCTGAGTTAGTCATTTCAAGGTCTTA (XhoI)
pstsR3forward CCCCTCGAGGCCCGCCTACAGGATCTGCTCA (XhoI)
pstsF0reverse CGTCTAGATGCGGACTGCTGGGAAGATG (XbaI)
pstsF1reverse CGTCTAGACCTCAATGGATGCAGCATCGGAAG (XbaI)
pstsF2reverse CGTCTAGATCAGACTCATTGGAGTCGGAGCAA (XbaI)
pstsF3reverse CGTCTAGAGTTCACGGGGAAGCCTTTCCGG (XbaI)
pstsF4reverse CGTCTAGATAAGACCTTGAAATGACTAACTCAGG (XbaI)
pstsFc_reverse CGGTTTCCCTCCGGATTGCTCACGACTTAAAAACCTA
pstsFm_reverse CGGTTTCCCTCCGGATTGCGCGCGGAGTAAAAACCTA
pstsRc_forward CCCGATGTGGGTAGTGGCAGAATTTGCCGAACGAT
pstsRm_forward CCCGATGTGGGTAGTGGCAGAAGAGGCCGAACGAT
pstsF0biotin Biotin-TGCGGACTGCTGGGAAGATGCAC
  1. *In some cases oligonucleotides were designed to introduce recognition sites for restriction endonucleases (recognition sites in italics)