Skip to main content

Table 4 Primers for PCR amplification of CGF 40 markers a

From: Development of a comparative genomic fingerprinting assay for rapid and high resolution genotyping of Arcobacter butzleri

  Product siz e (bp) Primer forward (5′ to 3′) Primer reverse (5′ to 3′) Concentration b (μM)
Multiplex 1 150 GCATCCTCTTCCTCCATCAT TCGAATAAATCCCCTACCCTT 12
250 ATACACCACCAGATGAGCTG TAACGTACCGCATCCATTGA 10
400 AGTGCCCGTTCTATTGGTAT GCATAAAGAGCTTCTCCTCC 8
500 ACTCTTCCCGAATCTGCAAT TCTCCAATTCCTTGTCCTATTGT 10
600 AGTCATGCAATCCTAACGAGA AGGAGCCTACTATGTACCTCT 10
Multiplex 2 150 TTTTCATTGGGAAGAAGAATTTAGT TCCAATTCATAAATATCTCTTGGTGA 12
250 TCTTTTAAAGAAGACAGCTGTAGT TTTTGCAACACCTAATCTTGC 18
350 TGATACAGGAATTATAAGAAGTGTTCC GCATGAACTTCAACTCCAGG 5
450 TGGAAATGACAGAGGATGGT AGTAACGGATGAGCTTTTAAATTT 8
600 TTGGGCTATTATGTCCCCAG TCGTACAACTGGCATAGCTT 7
Multiplex 3 200 CCTCAACTTCTAACAGCAGG CTCACATCACCCAATCCACT 8
300 TGGAATATCATAAACCAAAAATTGTTT TTCATTGCAAATCCGCCTTT 10
450 ACAGCATCCTTGATTCTAGCA GTGTAATCATAGCCCAAATCCA 12
550 TGAAATAATGAATGAACACAATAGCA GTGCACAACCTAAAACCTCA 10
700 GACAGGAACAGAGGGAAGTC AGCATCTTTATTTGTCGCACT 10
Multiplex 4 200 TGATGAAACACTAGAAAATAAGGCT CCAGTAAAACCTCTGTCAGC 11
350 TCACTTTTAGGTACTCACGACT GCTATAAAACTTGCACCTTTATCG 9
450 CAAAGATTTCTACGGGAAATTTGT ACATCCTTTGCCTCTTTAAAAGA 9
550 TCGAGGACAAGCAGATTCAA GCCATTTCTACTTCCATTGTGT 7
700 ACAGCAGTAACATTACAGGG TCAAAAGCAATTCCACCACT 11
Multiplex 5 150 TCTATAGGTGCTGACCCACT GCCGCAATACTTCCAAAACT 9
250 TTTACAGGAGCTTGGACATCA TTTTACCATCATCTTCAACCCA 9
400 CATCGTCCTTCAGTCGAATAT GGAAACCATTTTCTTTTGCCA 9
550 GTCATTTTTACACCACCTGCA TCAAAACGCTTAGCCAAATCT 12
700 ACTTTTTGCTTCTCAAAGTAGAAC CCTCTGAAAAATTGAAATAATATACCC 10
Multiplex 6 150 GGTTGGGGAAAACTGCTTTT TCTCTTGATTTTTAGTTTCAATCTCT 10
250 TGCTATGGGTGCAATGGTTA AAGATTCTAGCAACACCCGA 8
400 TGGGGACATGAAAACTGGAA TTCACATACTTTCTCAGGCATT 10
550 ACTATGGCTATATATGCGAAGAAA TCCATAAATGTTTCAACTCAGGA 10
650 GGAATTGCCGAGTTTACACG TGAGCTCCATGTTGTATTGGA 10
Multiplex 7 200 ACTCCATTTGTGCTTATTGGA TCTTGAACTAGCCAAAAGTGC 10
350 TCGAAATATCTTTTAGCTTCAAGAA AAAACATCATTTTCTTTTGCCCA 10
450 AGAGTTTGGATGGAAAACTGT TGCAACTATTCCATCAAAACCA 10
550 GGTTCAACACCAGGAACAAA TGCAACACCTATCATCTCATTT 10
700 GGAAAAGGCAAAGAATCCTCA ACCATCGCCAGACTTCATTA 10
Multiplex 8 150 TGCAAGAAATGGTGGAACAA CCTGTTGCAATAGTTGGTGT 10
250 TGGTAGAAGAAACAATAAAAAGATTTG AGTCTTGATTTATCGACAGTTCT 10
350 TTTTGTTTGAAGCTTATTCGTGA AGTCCATATCCTTTCTCTCTCA 8
450 AGGAGCTGTTGAGATTTTCAA GTCGTTGCTCATCTGCTTTT 7
550 GATGCTGGATTTTGTATGGCT AGCCAAGAAACTTTCAATATCTCT 10
  1. aPrimer pairs were selected and grouped into multiplexes using Primer3 [56], multiPLX [57], and CGF Multiplexer [25].
  2. bMultiplex primer pair concentrations were optimised for Ta = 60°C.