Skip to main content

Table 2 Oligonucleotides used in this study

From: Characterization of the β-barrel assembly machine accessory lipoproteins from Borrelia burgdorferi

Name Sequence (5’ to 3’, restriction sites in bold) Description
BamA P1 (NheI) F GCGGCTAGCAAGGGGAAAATAATAAAGGGTAT bamA nucleotides 82–104 plus NheI site (N-terminus of POTRA 1)
BamA P4 + 14 (XhoI) R GCGCTCGAGATTTTTATTTTTAGAAACAGTAATAG Complementary to bamA nucleotides 1079–1104 plus XhoI site (14 aa into POTRA 5 domain)
bb0028 (NheI) F GCGGCTAGCCTGCAAAAAATAAAACATGAATAC bb0028 nucleotides 109–132 plus NheI site
bb0028 (XhoI) R GCGCTCGAGTTCTTTAGTTAATTTTCTGTTTTCC Complementary to bb0028 nucleotides 1023–1047 plus XhoI site
795a (BamHI) F GCGGGATCCATGGGTTCAATTAGAGGTTTGT bamA nucleotides 1–22 plus BamHI site
795a (XbaI) R GCGTCTAGAATCAGGAACTTCCCTCTTGC Complementary to bamA nucleotides 1562–1581 plus XbaI site
795b (SalI) F GCGGTCGACCCATTTACAAGTTGGGAAGAAT bamA nucleotides 1582–1593 plus SalI site
795b (PstI) R GCGCTGCAGTCAATATCTCATCTCAATTCCTA Complementary to bamA nucleotides 1562–1581 plus XbaI site
flgB (BamHI) F GCGGGATCCTACCCGAGCTTCAAGGAAGAT flgB promoter nucleotides 1–21 plus BamHI site
flgB (BamHI) R GCGGGATCCATGGAAACCTCCCTCATTTAAA Complementary to flgB nucleotides 387–408 plus BamHI site
c-Myc (XbaI-SalI) F GCGTCTAGAGAACAAAAACTTATTTCTGAAGAAGATCTGGTCGACGCG c-Myc tag plus 5’ XbaI and 3’ SalI sites
c-Myc (XbaI-SalI) RC GCGGTCGACCAGATCTTCTTCAGAAATAAGTTTTTGTTCTCTAGACGC Complementary to c-Myc tag plus 5’ SalI and 3’ XbaI sites
KO324 downstream (KpnI) F GCGGGTACCGATTATTTGGGCAGATATCAAG Complementary to nucleotides 330,248-330,269 of B31 chromosome (600 bp downstream of bb0324) plus KpnI site
KO324 downstream (XhoI) R GCGCTCGAGTAATTTAAGAAATAAAAATTTTTACTG Nucleotides 329,622-329,648 of B31 chromosome (immediately downstream of bb0324) plus XhoI site
KO324 upstream (BamHI) F GCGGGATCCTTATAGCAATAATAAGCTTATAAAG Nucleotides 328,661-328,685 of B31 chromosome (600 bp upstream of bb0324) plus BamHI site
KO324 upstream (EcoRI) R GCGGAATTCTTCTGCCTCTTTTAGAATGTTTT Complementary to nucleotides 329,239-329,262 of B31 chromosome (immediately upstream of bb0324), plus EcoRI site
flgB (XhoI) F GCGCTCGAGTACCCGAGCTTCAAGGAAG flgB nucleotides 1–21 plus XhoI site
Strep (EcoRI) R GCGGAATTCTTATTTGCCGACTACCTTGGTGAT Complementary to aadA nucleotides 769–792 plus EcoRI site
0028 F 4–29 (EcoRI&NdeI) GCGGAATTCCATATGAAACAAAAATACGAAAACTATTTTAA bb0028 nucleotides 4–29 plus EcoRI and NdeI sites
0028 R 678–699 (BamHI) GCGGGATCCACCACCAGTCATTACTAAAACT Complementary to bb0028 nucleotides 678–699 plus BamHI site
0027 F 4–29 (KpnI) GCGGGTACCAGAAAGTATATTTTTATAATACTAAT bb0027 nucleotides 4–29 plus KpnI site
0027 R 613–636 (XhoI) GCGCTCGAGCAATTTATTTACATTCACTGTAAC Complementary to bb0027 nucleotides 613–636 plus XhoI site