Skip to main content

Table 3 Primers used in this study

From: An alternate route to phosphorylating DegU of Bacillus subtilis using acetyl phosphate

Primer Target Sequence a
NSW10 degU (H 12 L) GCTAGAGTATATAAAGCTTGAACAATAATACAAGGAG
NSW11 degU (H 12 L) GCCTAAAAAAAGCATGCGACCTGCCTAGTAAAAGG
NSW79 degU CGTGGCCCATGGCTAAAGTAAACATTG
NSW80 degU ATAAGATCTCATTTCTACCCAGCC
NSW1649 degU TGATGTTGTGATCATGAATATCAATATGCCAAACG
NSW1650 degU CGTTTGGCATATTGATATTCATGATCACAACATCA
  1. aengineered restriction sites are indicated by italics and nucleotides for mutagenesis are highlighted in italic bold text.