Skip to main content

Table 2 Oligonucleotides used for this study

From: A Pseudomonas fluorescens type 6 secretion system is related to mucoidy, motility and bacterial competition

Primer name Primer sequence (5′-3′)
PFL_1449mucAF ATAATAAGAGCTCATGAGTCGTGAAGCCCTGC
PFL_1449mucAR ATAATAATCTAGATTAGCGGTTTTCCAGGCTTG
Hcp1F ATGGCAACACCAGCGTACATG
Hcp2R TTAAACGACTGGAGCACGCCA
Hcp3F CCTGATCACTGCCGGCGCTT
Hcp4R ACGCCAGTCATCGGAACCCG
muta1tssC CTGAGACTCCAGTAGCCAAG
muta2tssC AAGCTTTCCAGACCGAAGAAATACTTCGTGGGTCCAGGTGAT
muta3tssC ATCACCTGGACCCACGAAGTATGAAGGCTTCATCTCCCTGAC
muta4tssC ATGTCATTGAGATCGGGCAA