Skip to main content

Table 1 Oligonucleotides used for qRT-PCR in this study

From: Enhancing pili assembly and biofilm formation in Acinetobacter baumannii ATCC19606 using non-native acyl-homoserine lactones

Locus tag Forward primer (5′-3′) Reverse primer (5′-3′)
16s DNA* GTAATACAGAGGGTGCGAGCGTT TCTAGCTGACCAGTATCGAATGCA
csuA/B CAGCAGCAACAGGTGGCAATA AAGGTTTGTACGTGCAGCATCA
csuA TATTGCCTTCTTGTTCTG CAGTTGAAATACCAGCAC
csuB TATGCAGCAGATCCTCAG TAAACTTTCCGTACAACG
csuC TGGTCAGAAGTTTGCGCGTC ACCAGAACTGTCCACACCATAAATT
csuD CCGGTTCCCTAATTTATATGGCA TAAGGCGTCACCGATGGCA
csuE GCTTGGCTTTAGCAAACATGACC ATTGCCATCAGGCCCGCTA
BfmS ACCGCCCGTAATCCGAAC TGAACTTATTCCACCGCCTTTA
BfmR GTTTAACCGTTTGTCGTG GTGGTTGAACTGGTTTCG
  1. *Oligonucluotides used as references.