Skip to main content

Table 1 Amplification conditions, oligonucleotide combinations, sequence and amplification fragment of multiplex-PCR for K. variicola identification

From: Development of a Multiplex-PCR probe system for the proper identification of Klebsiella variicola

Amplification conditions a Name of combination primers Shared unique genes, oligonucleotides and sequence (5′- 3′) of each bacterial specie
K. pneumoniae Amplification fragment (bp) K. variicola Amplification fragment (bp) Klebsiella spp. Amplification fragment (bp)
   phosphohydrolase   phosphoglycerate mutase   phosphopentane phosphatase (mtnC)  
1 M-PCR-1 KP888-F: AAGCAAGCCAGAACAGAAAG 888 KV770-F: TCCCGAGGTTCACATTTCC 449 KmtnC-F: CCGCCGACCTTATCACTAC 340
   KP888-R: ACTTCGGTTTTATCCAGGTC   KV770-R: AGCGGGTGAACGTCGATAC   KmtnC-R: AGCGGGTGAACGTCGATAC  
   transferase (yphG)   N-acetyltransferase   phosphopentane phosphatase (mtnC)  
1 M-PCR-2 KP878-F: ACCGATAACCAGCCTGACTT 878 KV1615-F: ACACAACATTTCAGGCGGCT 499 KmtnC-F: CCGCCGACCTTATCACTAC 340
   KP878-R: CTTTCTTCTGCCCACTGTTG   KV1615-R: GGGCGTGGCTTTTTTCATCG   KmtnC-R: AGCGGGTGAACGTCGATAC  
   phosphohydrolase   thiopurine S-methyltransferase   phosphopentane phosphatase (mtnC)  
2 M-PCR-3 KP888-F: AAGCAAGCCAGAACAGAAAG 888 KV1000-F: CTGGGATGTGGCAATGGTG 438 KmtnC-F: CCGCCGACCTTATCACTAC 340
   KP888-R: ACTTCGGTTTTATCCAGGTC   KV1000-F: AAACTGCGCCTGCTGTATC   KmtnC-R: AGCGGGTGAACGTCGATAC  
  1. aMultiplex-PCR conditions used under the oligonucleotides combinations. 1: 5pmol/reaction of K. variicola and Klebsiella spp, 25pmol/reaction of K. pneumoniae; 2: 25 pmol/reaction of K. pneumoniae, 5 pmol/reaction of K. variicola and 1 pmol/reaction of Klebsiella spp.