Skip to main content

Table 3 Primers used in this study

From: The VieB auxiliary protein negatively regulates the VieSA signal transduction system in Vibrio cholerae

Primer Name Primer Sequence 5′ − 3′
GST-VieS-C F tcactgtgcatatgactgagcagctacgttggttgacgg
GST-VieS-C R gagcgagtcggatcctcagagataacgactgagtactttgcgc
GST-VieS-C T2916C F gttgattactgactgccacatgccacatcttgatg
GST-VieS-C T2916C R catcaagatgtggcatgtggcagtcagtaatcaac
VieB F tcactgtgcatatggctgtacctacttttgctgaattaaaag
VieB R gagcgagtcggatccttacgcctcaactgattcgcttcgc
VieB D62A F gatttgatatttttatttgcgcttacaacttcggtaaggggtt
VieB D62A R aaccccttaccgaagttgtaagcgcaaataaaaatatcaaatc
VieB D62E F gatttgatatttttatttgcgagtacaacttcggtaaggggtt
VieB D62E R aaccccttaccgaagttgtactcgcaaataaaaatatcaaatc
MBP-VieS-C F CGCGGATCCTTACGCAGCTCCGAACAAG
MBP-VieS-C R ACGCGTCGACTTATTCGCTCTGATACTGATG
MBP-VieS-C D1018A F TATGGCAATTGGTAATCAACAAATCATACTGCTCAGGATGTTGCGAGAGCTTTT
MBP-VieS-C D1018A R CGAAAAGCTCTCGCAACATCCTGAGCAGTATGATTTGTTGATTACCAATTGCCA
  1. All primers are listed 5′ to 3′. Italics indicate restriction enzymes used for cloning.