Skip to main content

Table 1 Primers used for real-time PCR

From: Lactobacillus reuteri I5007 modulates tight junction protein expression in IPEC-J2 cells with LPS stimulation and in newborn piglets under normal conditions

Genes Primers Sequences (5'-3') Size (bp) Tm (°C)
TNF-α Forward ATTCAGGGATGTGTGGCCTG 120 62
  Reverse CCAGATGTCCCAGGTTGCAT   
IL-6 Forward TGGATAAGCTGCAGTCACAG 109 54
  Reverse ATTATCCGAATGGCCCTCAG   
Claudin-1 Forward GCAGCAGCTTCTTGCTTCTC 664 58
  Reverse CTGGCATTGACTGGGGTCAT   
Occludin Forward ATCAACAAAGGCAACTCT 157 50
  Reverse GCAGCAGCCATGTACTCT   
ZO-1 Forward GAGTTTGATAGTGGCGTT 298 50
  Reverse GTGGGAGGATGCTGTTGT   
β-actin Forward TGCGGGACATCAAGGAGAAG 216 60
  Reverse AGTTGAAGGTGGTCTCGTGG