Skip to main content

Table 2 Primers used for real-time quantitative PCR

From: Starch and starch hydrolysates are favorable carbon sources for Bifidobacteria in the human gut

Gene ID Primer sequence (F/R: 5′-3′) Product size (bp) Reference
16S CTGAGATACGGCCCAGACTC 279 [41]
AAGCGATGGACTTTCACACC
BBMN68_650 CGTACGTCCGAAGTTCCCCG 199 This study
CACGGTCAGGGAATGCTGGG
BBMN68_1600 CAGGATTCGAACGGGGACGG 187 This study
CCATATCCTCGAGCGTGCCG
BBMN68_1261 GCGCAACGGCACCACATATC 171 This study
GCGGTCGGATCCTCCAAGT
BBMN68_1670 GAGACCGATGGCTCCAAGGC 168 This study
GGAGGTCATGAACAGCGGGG
BBMN68_1430 GGCTCAGCGTAACGAGCACA 169 This study
GTTCTGCACGGCAGTCTGGT
BBMN68_1428 GATGTGGATCCCCGCCTTGG 157 This study
CCGATTCCGGACCTTGAGCC
BBMN68_1403 GCCTTCTCCCTGAAGGTTGT 111 This study
GTCGGACATGACCTGGGAAG
BBMN68_1257 CGTATGGGTGACCAACTGGG 147 This study
GGCGTAGTAGTAGCCGGAGA