Skip to main content

Table 2 Primers used in this study

From: Regulatory elements involved in the expression of competence genes in naturally transformable Vibrio cholerae

Primer name Sequence Description
(in 5′ to 3′ direction)
Rev[VC1917]-NotI GCGGCCGCGAGCTCTAGAGGTTTCTTAG For inverse PCR leading to plasmids:
pBR-[−700]comEA,
pBR-[−500]comEA,
pBR-[−300]comEA,
pBR-[−100]comEA,
pBR-[−40]comEA
Fwd[VC1917]-700 AGAGCTCGCGGCCGCAGGTGTTAACCACTCCTGCGGTAC Inverse PCR to generate
pBR-[−700]comEA
Fwd[VC1917]-500 AGAGCTCGCGGCCGCCAACAAGCACTTGAACTGGGTAAC Inverse PCR to generate
pBR-[−500]comEA
Fwd[VC1917]-300 AGAGCTCGCGGCCGCTATCGTTGTGATTGAGTTGAGC Inverse PCR to generate
pBR-[−300]comEA
VC1917-134-NotI GCGGCGGCCGCATTCTTAGTGTAATTGATATG PCR to generate
pBR-TET_MCS after ATCATGCGCACCCGTGGCCAGGACCC pBR[−134]comEA,
Fwd[VC1917]-100 AGAGCTCGCGGCCGCGGGCTACAGCAGTAGCCCGTTC Inverse PCR to generate
pBR[−100]comEA
Fwd[VC1917]-40 AGAGCTCGCGGCCGCCGCTATCATAAGCCCTCAACAAC Inverse PCR to generate
pBR[−40]comEA
gyrA-157-fwd AATGTGCTGGGCAACGACTG qRT-PCR for gyrA transcription [10]
gyrA_332_bwd GAGCCAAAGTTACCTTGGCC
comEA_50_fwd CGACATTACCGTTACTGGCC qRT-PCR for comEA transcription [10]
comEA_224_bwd CCGTTGGCTTCTCGATAATCG
comEC_1029_fwd GGTCGCGATTGTTCTCTACC qRT-PCR for comEC transcription [10]
comEC_1186_bwd CCAAATTGTACAGAACTGCCG
VC0396_188_fwd GCCTGATTCGCCAGCAATTG qRT-PCR for qstR transcription [22]
VC0396_356_bwd CCAAGACCGTGGGCAATAAAG
hapR-230-fwd CCAACTTCTTGACCGATCAC qRT-PCR for hapR transcription [22]
hapR-399-bwd GGTGGAAACAAACAGTGGCC
hapA_175_fwd ACGGTACAGTTGCCGAATGG qRT-PCR for hapA transcription [22]
hapA_358_bwd GCTGGCTTTCAATGTCAGGG
comEA_284_rev CGCACTGTCGCTTCACCAATCC 5′RACE: synthesis of first strand cDNA of comEA
comEA_217_rev CTTCTCGATAATCGACAATGGCCTGAGC 5′RACE: PCR amplification of Poly(A) cDNA comEA
oligo dT-Anchor primer (Roche) GACCACGCGTATCGATGTCGAC
F-EcoRI_Anchor_P CCAAGAATTCGACCACGCGTATCGATGTCGAC 5′RACE: PCR fragment of Poly(A) cDNA comEA cloned into plasmid pBR-Tet_MCSI
R-BamHI_comEA_217 CCAAGGATCCCTTCTCGATAATCGACAATGGCCTGAGC
T7RNA-pol-750-down GCTGAGGCTATCGCAACCCGTGC DNA uptake assay: amplification of donor DNA; primer specific for E. coli BL21(DE3); [9],[13]
T7 RNAP-end-bw TTACGCGAACGCGAAGTCCGACTCTAAG
lacZ-missing-fw GCCGACTTTCCAATGATCCACAATGGG DNA uptake assay: amplification of acceptor DNA; primer specific for V. cholerae A1552 and lacZ+ derivatives of it; [9],[13]
lacZ-missing-bw CCCTCGCTATCCCATTTGGAAATGCC
\