Skip to main content

Table 2 List of primers used in the present study

From: Mitogen-activated protein kinase Hog1 is activated in response to curcumin exposure in the budding yeast Saccharomyces cerevisiae

S.no. Gene Forward primer sequence (5′-3′) Reverse primer sequence (5′-3′)
1 HOG1 GGATGCCTTGGCTCATCCTT TGGTCATCAAACGTGGCAGA
2 GPD1 CATTGCCACCGAAGTCGCTC AACCACAACCTAAGGCAACAACG
3 ALG9 TGCATTTGCTGTGATTGTCA CAGGCAGTGGGAAATTCAGT