Skip to main content

Table 1 C. albicans primers used for qPCR

From: Extracellular DNA release confers heterogeneity in Candida albicans biofilm formation

Gene Sequence (5′ - 3′) Function
ALS3 F - CAACTTGGGTTATTGAAACAAAAACA Adhesin
R - AGAAACAGAAACCCAAGAACAACCT
HWP1 F - GCTCAACTTATTGCTATCGCTTATTACA Hyphal wall protein
R - GACCGTCTACCTGTGGGACAGT
CHT2 F – TGATTTATTATCCAAAGTCCCACTTG Chitinase
R – TTGAATTGGCCATTGATTGAA
CHT3 F - TGCTACTATTCCAGATGACAAAGAAATT Chitinase
R - TTCAGTGATGATAGCAGGTGGTTT
ACT1 F - AAGAATTGATTTGGCTGGTAGAGA Actin - housekeeping
R - TGGCAGAAGATTGAGAAGAAGTTT