Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Cross-feeding by Bifidobacterium breve UCC2003 during co-cultivation with Bifidobacterium bifidum PRL2010 in a mucin-based medium

Purpose Primer Sequence
Cloning of 400 bp fragment of fucP (Bbr_1742) in pORI19 FucPF TAGCATAAGCTT GGCGAATCGTTCGTATCA
  FucPR GATATCTCTAGA GCGCCCCAGTGCTTGAGC
Cloning of 479 bp fragment of lnbP (Bbr_1587) in pORI19 LnbPF TAGCATAAGCTT CACACAGGTATTGGGAGGTTG
  LnbPR CTAGTCTCTAGA GTTGTAGGCGCCACCATCC
Cloning of 568 bp fragment of lacZ7 (Bbr_1833) in pORI19 LacZ7F TAGCATAAGCTT CCAGGCCAAGAACTCCAGTG
  LacZ7R CATGATTCTAGA CAGCTTGGGCAGGTTGAACG
Amplification of tetW TetWF TCAGCTGTCGAC ATGCTCATGTACGGTAAG
  TetWR GCGACGGTCGAC CATTACCTTCTGAAACATA
Confirmation of site-specific homologous recombination FucPconfirm TGTTCGCCATGTTCGTTATC
  LnbPconfirm GATCACTCTGCATATGGACG
  LacZ7confirm GTACCGACATCGACGCGTTC
  1. Restriction sites incorporated into oligonucleotide primer sequences are indicated in italics.