Skip to main content

Table 2 Sequences and PCR cyclic conditions of primers used for detection of selected serogroups, virulence genes and molecular typing

From: Virulence and genotypic characterization of Listeria monocytogenes isolated from vegetable and soil samples

Target gene Primer sequence (5’-3’) Direction Amplicon size(bp) PCR cyclic conditions References
lmoO737 AGG GCT TCA AGG ACT TAC CC F 691 94°C × 5'; (94°C × 30s, 54°C × 75′s, 72°C × 75′s)35; 72°C × 10' [8]
ACG ATT TCT GCT TGC CAT TC R
lmo1118 AGG GGT CTT AAA TCC TGG AA F 906 Do [8]
CGG CTT GTT CGG CAT ACT TA R
ORF2819 AGC AAA ATG CCA AAA CTC GT F 471 Do [8]
CAT CAC TAA AGC CTC CCA TTG R
ORF2110 AGT GGA CAA TTG ATT GGT GAA F 597 Do [8]
CAT CCA TCC CTT ACT TTG GAC R
Prs GCT GAA GAG ATT GCG AAA GAA G F 370 Do [8]
CAA AGA AAC CTT GGA TTT GCG G R
inlA ACG AGT AAC GGG ACA AAT GC F 800 94°C × 2'; (94°C × 20s, 55°C × 20s, 72°C × 50s)30; 72°C × 2' [7]
CCC GAC AGT GGT GCT AGA TT R
inlC AAT TCC CAC AGG ACA CAA CC F 517 Do [7]
CGG GAA TGC AAT TTT TCA CTA R
inlJ TGT AAC CCC GCT TAC ACA GTT F 238 Do [7]
AGC GGC TTG GCA GTC TAA TA R
plcA CTG CTT GAG CGT TCA TGT CTC ATC CCC C F 1484 95°C × 2'; (95°C × 15′s, 60°C × 30s, 72°C × 90s)35; 72°C × 10' [60]
CAT GGG TTT CAC TCT CCT TCT AC R
prfA CTG TTG GAG CTC TTC TTG GTG AAG CAA TCG F 1060 Do [60]
AGC AAC CTC GGT ACC ATA TAC TAA CTC R
actA CGC CGC GGA AAT TAA AAA AAG A F 839 Do [61]
ACG AAG GAA CCG GGC TGC TAG R
hlyA GCA GTT GCA AGC GCT TGG AGT GAA F 456 Do [62]
GCA ACG TAT CCT CCA GAG TGA TCG R
Iap ACA AGC TGC ACC TGT TGC AG F 131 Do [63]
TGA CAG CGT GTG TAG TAG CA R
REP1R-I IIIICGICGICATCIGGC F Several 95°C × 7'; (95°C × 1', 44°C × 1', 65°C × 8')30; 65°C × 10' [52]
REP2-I ICGICTTATCIGGCCTAC R
ERIC1R ATGTAAGCTCCTGGGGATTCAC F Several 95°C × 7'; (95°C × 1', 52°C × 1', 65°C × 8')30; 65°C × 10' [64]
ERIC2 AAGTAAGTGACTGGGGTGAGCG R