Skip to main content

Table 6 Real-time quantitative RT-PCR confirmation of selected genes

From: Microarray analysis of the transcriptional responses of Porphyromonas gingivalis to polyphosphate

Locus no.a Primer sequence (5′-3′)b Product size (bp)
16S rRNA F: TGTTACAATGGGAGGGACAAAGGG 118
R: TTACTAGCGAATCCAGCTTCACGG
PG0090 F: CAGAAGTGAAGGAAGAGCACGAAC 197
R: GTAGGCAGACAGCATCCAAACG
PG0195 F: TCCACGGCTGAGAACTTGCG 149
R: TGCTCGGCTTCCACCTTTGC
PG1545 F: CCAAACCCTCAACCACAATC 142
R: GGTACCGGCTGTGTTGAACT
PG0593 F: CGTGTGGGAGAGTGGGTATTGG 175
R: CGCCGCTGTTGCCTGAATTG
PG1089 F: CCATCGCGATCGATGATCAGGTAA 104
R: GGCATAGTTGCGTTCAAGGGTTTC
PG1019 F: TTCGCAGTATCCCATCCAAC 126
R: TCCGGCTCATAGACTTCCAA
PG1180 F: CAGTCTGCCACAGTTCACCA 124
R: CCCTACACGGACACTACCGA
PG1983 F: GCTCTGTGGTGTGGGCTATC 146
R: GGATAACAGGCAAACCCGAT
PG0885 F: CAGATCCAAATCGGGACTGA 156
R: GTAGAGCAAGCCATGCAAGC
PG1181 F: GATGAATTCGGGCGGATAAT 184
R: CCTTGAAGTGCTCCAACGAC
  1. aBased on the genome annotation provided by TIGR (http://cmr.jcvi.org/cgi-bin/CMR/GenomePage.cgi?org=gpg).
  2. bPrimers were designed using Primer3 program for the study except for the primers of P. gingivalis 16S rRNA and PG1089 [49], which were prepared based on the primer sequences published previously. The 16S rRNA gene was used as the reference gene for normalization. F, forward; R, reverse.