Skip to main content

Table 1 List of oligonucleotides used for this study

From: Promoter analysis of macrophage- and tick cell-specific differentially expressed Ehrlichia chaffeensis p28-Omp genes

Primers Sequence Orientation Amplicon size
(bp)
Annealing temperature
(°C)
PROMOTER ANALYSIS
Gene 14-upstream sequence primers
For cloning into pPROBE-NT
RRG 183* 5' GACTCTAGAttgctcaacccataaaataatg Forward 596 50
RRG 184 5' AGTGAGCTCtttataaaagataataaaaatttaag Reverse   
For cloning into pBlue-TOPO
RRG 217 5' attgctcaaccataaaataatggga Forward 581 48
RRG 218 5' gttaataaaccttttataaaag Reverse   
RRG 267 5' cagttaactttctgtaaacttc Forward 521 48
RRG 218**   Reverse   
RRG 268 5' atcataagtttacaataatgtc Forward 461 48
RRG 218   Reverse   
RRG 269 5' cgttttctgctttattagaatg Forward 400 48
RRG 218   Reverse   
RRG 270 5' gttccgtatttattaatatatg Forward 350 48
RRG 218   Reverse   
RRG 271 5' catgtactgaatttgtgatttg Forward 286 48
RRG 218   Reverse   
RRG 272 5' ggataagtactttagcaagtgg Forward 222 48
RRG 218   Reverse   
RRG 273 5' taagtagtaaagttaactatag Forward 169 48
RRG 218   Reverse   
RRG 274 5' acttttgttgtaaatttgaaag Forward 105 48
RRG 218   Reverse   
RRG 217   Forward 516 50
IG14-35 del R 5' (PO4)-gtctagaatataaaatttctttc Reverse   
IG14-10 del F 5' (PO4)-taaatttttattatcttttataaaaggtttattaac Forward 8366 56
IG14-10 del R 5' (PO4)-atgaaagaaataaagaaaagcaagtctag Reverse   
IG14-35 del F 5' (PO4)-ttctttatttctttcattattc Forward 8366 48
IG14-35 del R   Reverse   
IG14-10 del F   Forward 8343 51
IG14-35 del R   Reverse   
Gene 19-upstream sequence primers
For cloning into pPROBE-NT
RRG 185 5' GACTCTAGActtttaattttattattgccacatg Forward 334 61
RRG 186 5' AGTGAGCTCaatagtgacaaataaattaacaatag Reverse   
For cloning into pBlue-TOPO
RRG 185   Forward 308 60
RRG 445 5' atataacctaatagtgacaaataaattaac Reverse   
RRG 275 5' gtggcaaaagaatgtagcaataag Forward 239 50
RRG 445   Reverse   
RRG 276 5' gtgctgtttttctcacctttacac Forward 188 63
RRG 445   Reverse   
RRG 277 5' ctgacgtaatatattaaattttcc Forward 125 55
RRG 445   Reverse   
RRG 185   Forward 267 50
IG19-35 del R 5' (PO4)-gtcagaatataaatttttgtataaaatatcg Reverse   
IG19-10 del F 5' (PO4)-taatttatttgtcactattaggttat Forward 8112 56
IG19-10 del R 5' (PO4)-gtagaagtgtcatataaaagcaag Reverse   
IG19-35 del F 5' (PO4)-ttatatgacacttctactattgttaatttatttg Forward 8112 61.5
IG19-35 del R   Reverse   
IG19-10 del F   Forward 8088 58
IG19-35 del R   Reverse   
PRIMER EXTENSION ANALYSIS
Gene 14
RRG 14-5'rev 5' gccttctctgctgtcgttgattcc   NA 52
Gene 19
RRG 20-PEXT 5' cgttaataccactacctgctgggtcg   NA 58
RRG 44 5' cgcttccgtcccaattttgcttc   NA 58
IN VITRO TRANSCRIPTION ASSAY
Gene 14 upstream full-length+lac Z segment
RRG 217 5' attgctcaaccataaaataatggga Forward 882 50
RRG 226 5' cgccattcgccattag Reverse   
RRG 218 5' gttaataaaccttttataaaag Forward 882 50
RRG 226   Reverse   
Gene 19 upstream full-length+lac Z segment
RRG 217 5' attgctcaaccataaaataatggga Forward 601 50
RRG 226   Reverse   
RRG 445 5' atataacctaatagtgacaaataaattaac Forward 601 50
RRG 226   Reverse   
IN VITRO TRANSCRIPTION COUPLED TRANSLATION ASSAY
RRG 185 5' gactctagacttttaattttattattgccacatg Forward 848 58
RRG 247 5' tccggctcgtatgttgtgtg Reverse   
  1. * Text in capital letters refers to sequences inserted for creating restriction enzyme sites. ** Primer sequences were presented only once when a primer was described for the first time.