Skip to main content

Table 2 DNA Primers used

From: DNA polymorphism analysis of Brucella lipopolysaccharide genes reveals marked differences in O-polysaccharide biosynthetic genes between smooth and rough Brucella species and novel species-specific markers

Target DNA Primer name Sequence (5'-3') Amplicon size
manAO-Ag manA-A CATCACCATCGTTCAGAGCA 1804 bp
  manA-B GCCAGGGGAAATGATAATGA  
manBO-Ag manB-A GTTGGCAGAAGTTGGCATCG 2091 bp
  manB-B CTAATGCCTGTTCCGCCACC  
manCO-Ag manC-A TTGAAGACTGGTTTATTGCG 2210 bp
  manC-B GCAAGACTGCCATAGAAACC  
wbkE wbkE-A CCGCAAACTGAATGGATAAA 2452 bp
  wbkE-B GCAACTGTCAGGTCTGGTGC  
wbkF wecA-A GCGGAGGAATGGACAAGGAC 1234 bp
  wecA-B AGGAAAGCCTGGCGGTACTG  
wbkD wbkD-A TGGCTGGAGTGTGCCGAAAG 2165 bp
  wbkD-B ACGGTTGCTGGTGCTTGTGG  
wa** wa**-A CATCACGCATAATGACACCG 2342 bp
  wa**-B TGCTTTTGACAAGCTCGTCG  
manBcore manBcore-A CCAGCCGACGATTGAACTGG 1589 bp
  manBcore-B AAGCCTTGAACCCGATCCCC  
wboA wboA-A TCTGCATAACGGTCCTTGCC 1334 bp
  wboA-B GCTTTTACGGCAACAAGTCC  
wboB wboB-A CTTGGGATGCGAAACTACCG 1656 bp
  wboB-B GCTCACGCTTCCGAATACTG