Skip to main content

Advertisement

Table 4 Primer information for real-time qPCR.

From: Cervical cancer isolate PT3, super-permissive for adeno-associated virus replication, over-expresses DNA polymerase δ, PCNA, RFC and RPA

Gene name Size (bp) Forward primer sequence (5' – 3') Reverse primer sequence (5' – 3')
PT3-inducible genes    
   PCNA 66 GAACTGGTTCATTCATCTCTATGG TGTCACAGACAAGTAATGTCGATAAA
   POLD1 107 AGGTAGTACTGCGTGTCAATGG CCCTACGTGATCATCAGTGC
   RFC3 69 CACAGTAGATAACACGTGGCAAA AGTAGGTGCTTGGCGGTTC
   RFC4 77 TTCCAGGTGGTCCGTAAAAC AGAAGTGGTTGCAGTGCTGA
   RFC5 84 TGTGGCCGGTATTTTTCAAC GGAGACCTCAGCACTCAAGC
   RPA1 65 CCGTAGTAATGGGACGGATG GCAGAAGGGGGATACAAACA
   RPA2 95 TTCCAGAATATGTGTGGTGAACTC GCCACCTGAGATCTTTTCAGA
Reference genes    
   ACTB 97 CCAGAGGCGTACAGGGATAG CCAACCGCGAGAAGATGA
   GAPDH 66 GCCCAATACGACCAAATCC AGCCACATCGCTCAGACAC