Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Transcription profiles of hydrogenases related genes in the cyanobacterium Lyngbya majuscula CCAP 1446/4

Primera Sequence 5' → 3' Primera Sequence 5' → 3'
GWhox1R ATCAGCACCTCGTCCAGCAACATCCC LmhupW1R CGCAGTTCCGCAGTCAAAGATTCGCA
GWhox2F CGCTAAGTTACCCGAAGAAGCCGCCAC LmhupW2R TCAAAAACTGCACCGGGTTCT
GWhox3R CAACTTCTCGCTTAGGAAATATGTAGGG LmhupW3R GGTTCGGGTAATTGTTCAAGCTCT
GWhox4R CTAAATGACAGAGGACGGGAATATGAACC LmHCPR GGTTGATAACAACTGATCTCAGACCAT
GWhox5R ACCTTCTTCTACGGCAACGTCAATGTCG LmhoxHF d CGTGCGATCGCCCTTATCAGAAGA
GWhox6F GAGACCTCTATCACGATACTGTCCGCAC LmhoxHR d AGTTAGAATTAATTGCGGAAAACCTC
GWhox7R TAAGCCAATATCTTGACCCTGTTGTGC LmhoxUF1 CGACATTGACGTTGCCGTAGAAGAAGG
GWhox8R GATGGGGATCACTTTCAAGGACACTGCG LmhoxYF GATGTCACGCCGCAAATTCCGAAA
GWhox9R GAAGGGACTTTCACGATAACGAGCAG LmhoxWorfF1 TTATTCAAACTTTACGCAAGTCAAGGT
GWhox10F AGGAAAGGTAGTAGTGAAACAACCTG LmhoxWR2 CTGATGGAGTGCTAAACATTTCACAT
GWhoxW1F CTCCATCAGTTGCTTCCTGAAGTTG LmxisHR1 CAAATCTACAAACGTGGAACGTCC
GWhoxW1R GATGTCCCCAGTTAAGTTCAGTTGTTTC LmxisHR2 GCAAGATAAAGATAACGGTCTGGT
GW5Lmhox2R TTTGCGGCGTGACATCACCTAACTCTA LmxisHR3 CGTCTGTAATTGTCCAACCCTCTT
GW3LmhupWR1 TTTAGATTCCCACAACCAATAATCG LmxisHR4 AATCTCGTTCAGCTGCAATGAGTT
LahoxWF1 TTCGGGGTGATGATGG RChoxE1R ACCAGGGAAACTAAACCGTC
LahoxWR1 GGAACTGATATTAACCAAGC RChoxE2R TGAGGGAAAACAAATGGTAAAAGG
BD16SF1 CACACTGGGACTGAGACAC RChoxE3R GGAAGTTTGAGGTTACGGGCGAC
BD16SR1 CTGCTGGCACGGAGTTAG RChoxE4R GGTAAGGCACGGTTATTCC
BDhoxHF1 GATGATGCGGGCGAAGTTG RThoxE1F TTGGGGCTTGTGGGATTGC
BDhoxHR1 AGCGAGTAGGTGACTAACGG RThoxE2F TGAAACGCAGCCAATATCGT
BDhupLF1 ACACAAGCCCAACTATTTC RThoxF1F AGTCAAAGCCGTACAAACAG
BDhupLR1 CCAAGCGGTATCTAATGC RThoxF2F CAGTCGTCAACTGTTAGTCGTTCG
VNhoxWF1 CTCAAAAAACTGTCTTAGTGTTGG RThoxY1F ACGATTTGGTTAGCGGGTTGT
VNhoxWR1 GCTAAACATTTCACATTGGGAA Sqhox5R1R ATCACAACCGCCTACCAAGA
BDhupWF1 CTTTGGCTGCGGGTCGTC Sqhox6F1R CAACACCCATCACGGTCT
BDhupWR1 GATAATGCTGCTGTTGAGGTGATG Sqhox8R1R TCTATGTCAACCCGCCCA
LMS3'A b TCCCTTCCATGACCTCAAAC Sq8.2 TGCGCCTGTGGTTGTCTACGATG
LMH2B b GCCGCAAATTCCACAAACTCG Sq9RR1 GGAACTCAACACAACACAG
LMH4'A c GGCTATCTCCTTAACGAAGA Sq10F1F CGACAAGTTGAAGCAAGGAAG
LMH4'BF b ATCTGCGTCAGTTAGCCCGA SqWF1 CTGTATTTGTAAGAGTTGCC
LMH5A b GTGCAACAGAAGCCAGTCGC SqWF2 CGGCTTCATGGTTAAAGTC
   SqWF3 AGATCAGGAGGCGGATAAAC
  1. aF or A (forward) and R or B (reverse) designations refer to primer orientations in relation to the frame of the gene.
  2. bLeitão et al. [2].
  3. cSchütz et al. [4].
  4. dFerreira et al. [1].