Skip to main content

Table 1 Characteristics of tandem repeat loci TR6 and TR10.

From: Typing Clostridium difficile strains based on tandem repeat sequences

tandem repeat locus Locationa Size (bp) Copy no. Rangeb No. of different repeatsb Repeat consensus
TR6 725321 : 725600 21 7–37 80 CTTGCATACCACTAATAGTGC
TR10 3753166 : 3753574 22–23 4–26 51 AAATTAATTATTATATTTCTTT
  1. a Genome location based on C. difficile 630 sequence http://www.sanger.ac.uk.
  2. b Based on analysis of 154 isolates typed in this study.