Skip to main content

Table 2 Primers used in this study

From: RpoE fine tunes expression of a subset of SsrB-regulated virulence factors in Salmonella enterica serovar Typhimurium

Primer Sequenceab
BKC183 GCTCGAG TTTACCGCGCCGGATAACATACCG
BKC184 CACCAATTG TTAGCTGAATGAAGCAACCGTTGCCAG
BKC185 CCTCGAG CGATTGCCGTCAAAGGTATTC
BKC186 CACCAATTG TTACTGATCACCGTTCTCTACGGCGCT
BKC187 GGTTTGGGGAGACATTACCTCGGATGAGCGAGCAGTTA GTGTAGGCTGGAGCTGCTTCG
BKC188 CCTAATACCTTTTCCAGTATCCCGCTATCGTCAACG CATATGAATATCCTCCTTA
BKC195 CAGCTCACTATCCAACGTTT
BKC196 TGCTTGCTCATAGTGCGGCTT
BKC205 CACCAATTG TTACTATAGTAATCGGCATATTAA
BKC206 CCGCTCGAG TATGGCGCTGATCGCCAC
SEO005 CCGCTCGAG GTGCCATCCTTTGCCGTTT
SEO006 CACCAATTG TTACATGAATCCCTCCTCAGACAT
SEO011 CCGCTCGAG ATATGGAGAGTGGTAGAATAG
SEO012 CACCAATTG TTATAATTGTGCAATATCCATAA
SEO095 GCTCTAGA TCAACGCCTGATAAGCGGTT
SEO096 ACGCGTCGAC CCACTCTTTATTGCGATTCCA
  1. aunderlined nucleotides indicate restriction enzyme sites; XhoI (CTCGAG), MfeI (CAATTG)
  2. b bolded nucleotides indicate complementarity to rpoE