Skip to main content

Table 1 primers used in PCR and RT-PCR

From: DNA phosphorothioation in Streptomyces lividans: mutational analysis of the dnd locus

Primer Name Sequence (with the restriction enzyme sites underlined) Enzyme site
A2 ATCACCCCTTCCACCGAGAT  
A1 ACTGGATGACCGCGGAGTTC  
B1 GAGTACGTTTTTCCGGCCATCC  
B2 TCCTTCAGCGCCTGCTCGAT  
B3 CCAACACCGACTGGGAGGGG  
C1 CAGAGATCGTCGAGGAGCTG  
C2 GATCTTCAACCGCTCGGTGC  
C3 CAGTATCGAACCATGACCCGG  
D1 TGCGGCAAGACGACCCTGCT  
D2 GTCGGCGAGCTGTTCCACCT  
D3 CAGTGATCGACACCCCACTC  
E1 ATGCCGTCTGAGATCACCAT  
E2 ATAAGCAGCGTCTTGCCCAC  
16S rRNA SP AGTAACACGTGGGCAACTGC  
16S rRNA AP CTCAGACCAGTGTGGCCGGT  
xtg1 CCGATCTTGTGCCCGCTGATG  
xtg2 GCGCCTTAAGT CGTCCCTTGTTC Afl II
xtg3 GAAGGTGTCTTAGATCT CCGG Bgl II
xtg4 CTGGCACGACAGGTTTCC  
xtg5 AAGCACCGGT TCAAGACG Age I
xtg6 GCCCAGGTCCGCAAGAA  
xtg7 CTCGTGGTTGAGCGGGACTACGG  
xtg8 CTGGCACCGGT CAAGCCTAGG TG Age I, Avr II
xtg9 GGGACAGCCTAGG GGTGATC Avr II
xtg10 ACTGACCGCAGACCGCAAG  
wlr5 CATATG GTGGGATCTTCTGCAGCT Nde I
wlr6 GGATCC TCAATGATGATGATGATGATGTGACTCTCCTCGCAGGTA Bam HI
wlr7 CATATG AGCACCCCCAAGGCG Nde I
wlr11 GGATCC TTAGTGGTGGTGGTGGTGGTGTGCAGGTGCATCGGTGGTGA Bam HI
dnd-1 AGAGATCACCACATATG CACCTGAGCACC Nde I
dnd-2 CAGCCGGATCC TGATCTCAG Bam HI
dndE-L CACATATG CCGTCTGAGATCACC Nde I
dndE-R TAAGGCCTATTCGGCGGTGA