Skip to main content

Table 2 Oligos used for generating shRNA constructs by PCR and transfected into amebae

From: Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

Oligo Name Oligo Sequence
U6 HindIII forward CTACTGAAGCTTGTTTTTATGAAAAAGTGTATTTGC
GFP R1 TCTCTTGAAGTTTTCCGTATGTTGCATCACCTTGGGCCCAATTTTATTTTTCTTTTTATCC
GFP R2 TCGATCGCGGCCGCAAAAAAGGTGATGCAACATACGGAAAACTCTCTTGAA
Igl1 (272–300) R1 TCTCTTGAAATTTCCAGAGTGTGATGATGTATTTACTTGGGCCCAATTTTATTTTTCTTTTTATCC
Igl1 (272–300) R2 TCGATCGCGGCCGCAAAAAAGTAAATACATCATCACACTCTGGAAATTCTCTTGAA
Igl (1198–1226) R1 TCTCTTGAACAATGAGTTCCATTCAATGTAAGTCCATTGGGCCCAATTTTATTTTTCTTTTTATCC
Igl (1198–1226) R2 TCGATCGCGGCCGCAAAAAATGGACTTACATTGAATGGAACTCATTGTCTCTTGAA
Igl (2412–2440) R1 TCTCTTGAAGTCCACTAAAACCATCTGAACATTCTGTTGGGCCCAATTTTATTTTTCTTTTTATCC
Igl (2412–2440) R2 TCGATCGCGGCCGCAAAAAACAGAATGTTCAGATGGTTTTAGTGGACTCTCTTGAA
Igl (2777–2805) R1 TCTCTTGAATGGTGATGTGCATGGTATACATGTTCCTTGGGCCCAATTTTATTTTTCTTTTTATCC
Igl (2777–2805) R2 TCGATCGCGGCCGCAAAAAAGGAACATGTATACCATGCACATCACCATCTCTTGAA
URE3-BP (350–378) R1 TCTCTTGAAGTTCATAACGAAGAGATTGTATGCAAGTTGGGCCCAATTTTATTTTTCTTTTTATCC
URE3-BP (350–378) R2 TCGATCGCGGCCGCAAAAAACTTGCATACAATCTCTTCGTTATGAACTCTCTTGAA
URE3-BP (580–608) R1 TCTCTTGAAAATGGTTTCATTGGACCATAGTATGGATTGGGCCCAATTTTATTTTTCTTTTTATCC
URE3-BP (580–608) R2 TCGATCGCGGCCGCAAAAAATCCATACTATGGTCCAATGAAACCATTTCTCTTGAA
EhC2A (363–391) R1 TCTCTTGAATCATGCCTGGTTGCATTGGTGGAACCATTGGGCCCAATTTTATTTTTCTTTTTATCC
EhC2A (363–391) R2 TCGATCGCGGCCGCAAAAAATGGTTCCACCAATGCAACCAGGCATGATCTCTTGAA
EhC2A (502–530) R1 TCTCTTGAAATTGGTGGATATCCAGGTGGTGGGTAAGCGGGCCCAATTTTATTTTTCTTTTTATCC
EhC2A (502–530) R2 TCGATCGCGGCCGCAAAAAAGCTTACCCACCACCTGGATATCCACCAATTCTCTTGAA
EhC2A (363–391 scrambled) R1 TCTCTTGAAATCTGGAACGGTCTGGATTGTCTAGCCTTGGGCCCAATTTTATTTTTCTTTTTATCC
EhC2A (363–391 scrambled) R2 TCGATCGCGGCCGCAAAAAAGGCTAGACAATCCAGACCGTTCCAGATTCTCTTGAA
  1. The sequences shown in Table 1 were used to design primers for two-step PCR, based on the method used by Gou et al (2003) [30] and diagrammed in Figure 1A. The final PCR product contained the E. histolytica U6 promoter with a HindIII site on the 5' end, an ApaI site at the 3' end of the U6 promoter, the 29-nt sense strand of the hairpin, the 9 bp loop TTCAAGAGA, the antisense strand of the hairpin, and the U6 terminator sequence followed by a NotI restriction site. The forward primer, "U6 HindIII forward", contained the HindIII recognition site and the 5' end of the U6 promoter, the first reverse primer (R1) contained the sequence of the sense strand of the shRNA and the future loop, and the second reverse primer (R2) contained the loop sequence, the antisense strand sequence, and the U6 termination sequence. A control GFP sequence [30] was used to design oligos for creating a shRNA construct as a transfection control.