Skip to main content

Table 1 Sequences chosen to generate shRNA constructs that were successfully transfected into amebae

From: Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

Name Sequence Location in mRNA/cDNA (bp from ATG) Total length of target mRNA (bp)
Igl1 (272–300) AAGTAAATACATCATCACACTCTGGAAAT 272–300 (Igl1) 3306 (Igl1), 3318 (Igl2)
Igl (1198–1226) AATGGACTTACATTGAATGGAACTCATTG 1198–1226 (Igl1)  
Igl (2412–2440) AACAGAATGTTCAGATGGTTTTAGTGGAC 2412–2440 (Igl1)  
Igl (2777–2805) AAGGAACATGTATACCATGCACATCACCA 2777–2805 (Igl1)  
URE3-BP (350–378) AACTTGCATACAATCTCTTCGTTATGAAC 350–378 663
URE3-BP (580–608) AATCCATACTATGGTCCAATGAAACCATT 580–608  
EhC2A (363–391) AATGGTTCCACCAATGCAACCAGGCATGA 363–391 567
EhC2A (502–530) GCTTACCCACCACCTGGATATCCACCAA 502–530; also 406–434  
EhC2A (363–391 scrambled) AAGGCTAGACAATCCAGACCGTTCCAGAT Does not match any E. histolytica mRNA None
GFP AAGGTGATGCAACATACGGAAAAC Does not match any E. histolytica mRNA None
  1. The Ambion siRNA finder [51] was used to select 21 mers from the entire coding sequence of URE3-BP, the poly-proline region of EhC2A, or the identical or divergent regions of Igl1 and Igl2, which were then checked for sufficient GC content, lengthened to 29 nucleotides, and tested for sufficient sequence uniqueness by blasting each 29 mer using the E. histolytica Genome Project database [52]. A scrambled sequence was created as a control for EhC2A. A sequence directed against GFP [30] was included as a control for the Igl and URE3-BP selections. The constructs are named such that the numbers in parentheses following the gene name indicated the location of the shRNA sense strand within that gene sequence.