Skip to main content

Table 2 Oligonucleotide primers used in this study

From: Secretion of flagellin by the LEE-encoded type III secretion system of enteropathogenic Escherichia coli

Primer Sequence (5'-3')
fliC Δ F CGTAATCAACGACTTGCAATATAGGATAACGAATCATGGCACAAGTCAT
TAATACCTGTGTAGGCTGGAGCTGCTTCG
fliC Δ R GCATCAGGCAATTTGGCGTTGCCGTCAGTCTCAGTTAATCAGGTTACAAC
GACATATGAATATCCTCCTTA
fliCverifyF GAGTATTTCGGCGACTAAC
fliCverifyR GCAGGGTTTTAATCGGACG
fliI Δ F CCAGGAGTGGTGTAATGACCACGCGCCTGACTCGCTGGCTAACCACGCTG
GTGTGTAGGCTGGAGCTGCTTCG
fliI Δ R GGAGAGACGCTTCCCAGTCCGCGCGTTCAAAAATGCCTTGTTGCAAATAG
CCCATATGAATATCCTCCTTA
fliIverifyF GCTGGCAAGAACTCTGCCG
fliIverifyR GACACTGTCGGGAAAATACGC
fliS Δ F GCAGTTCGAAAACAACAGTAATTCCAAGTAATCATTATTCATCGGGAGAC
AGGTCTGTGTAGGCTGGAGCTGCTTCG
fliS Δ R GCTGGCTTTTTTCGACGAGTTGTTGCCAGGCGAAATATAAATGCGGTGCAT
GGTTCACATATGAATATCCTCCTTA
fliSverifyF CACGACCACCATCGGCAG
fliSverifyR GAATCAGGCGCAGCATCGGGC
fliC F CATGCCATGGCACAAGTCATTAATACC
fliC R CGCGGATCCTTAACCCTGCAGCAGAGAC
escF F GCTCTAGATCTGAGGGAAATTTAATG
escF R CCCAAGCTTTTAAAAACTACGGTTAGA
espADB Δ F GTCATGCTAAGAAAGATTATGAAGAGGTATATACATGGATACATCAACT
ACAGCTGTGTAGGCTGGAGCTGCTTCG
espADB Δ R GTTCAAGATAGTAATTAAACACTTCATCATTAAACGTATCGACCATGATC
AACATATGAATATCCTCCTTA
espADBverifyF CCTTCTCGGGTATCGATTGTCG
espADBverifyR CGTTAAGCCCTGTTTGGTTACG
pTrc99AF CGGTTCTGGCAAATATTC