Skip to main content

Table 1 Primers and probes used in the study

From: Induction of a chemoattractant transcriptional response by a Campylobacter jejuniboiled cell extract in colonocytes

Gene Forward Primer Reverse Primer Probe
β-actin TCACCGAGCGCGGCT TAATGTCACGCACGATTTCCC CAGCTTCACCACCACGGCCGA
Interleukin-8 ATTTTCCTAGATATTGCACGGGAG GCAAACCCATTCAATTCCTGA AAAATTGAGGCCAAGGGCCAAGAGAA
ATPase, Na+/K+ transporting, Beta1 polypeptide GCCCAGAGGGATGACATGAT CAGACCTTTCGCTCTCCTCG TTTGAAGATTGTGGCGATGTGCCCA
Syndecan 4 TGGGTGGTTGAGTGAGTGAATT CCTCAACTATTCCAGCCCCAT TTTCTCTTGCCCTGTTCCTGGTGCC
Retinoic acid receptor responder (tazarotene induced) 1 ACCCTGAGGAACCTGCTGGT TGGTTTTTTGTTTCTCAGTCTGCT TGAGCAGAGTTCAGTGTGCATGCGCT
tumor necrosis factor, alpha-induced protein 3 CTTTGAGTCAGGCTGTGGGC TTGGATGCAATTCCTTCTTTCC ACCACAGGGAGTAAATTGGCCTCTTTGATACA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha GGCCTCCAAACACACAGTCA GCTGCCAGAGAGTGAGGATGA CTCCGTGAACTCTGACTCTGTGTCATAGCTCTC
matrix metallo-peptidase 7 GATCCCCCTGCATTTCAGG CTGGCCCATCAAATGGGTAG TCATGATTGGCTTTGCGCGAGG
  1. Forward primer, reverse primer and Taqman probes for RQ-PCR assays used, all listed 5' - 3' direction.