Skip to main content

Advertisement

Table 3 Primers used in this study

From: Burkholderia thailandensis harbors two identical rhl gene clusters responsible for the biosynthesis of rhamnolipids

Primer Name Primer Sequence (5' to 3')
rhlASVF GCTCTAGA AGACGGTCATCCTCGTGAAC1
rhlASVR GGGGTACC CGGCAGCTTCGTCAGATAC1
rhlA1PF GGAAATGGTCGATGGGTATG2
rhlA2PF GGCGACGGATAGCGATAAG2
rhlAR TCGTGTACTCGTCCAGCTC
rhlATp1F GGCGGAATTCCGGCAGGTACTGCTCCGGCCGCATCGACAGGATCTGGTCCGAGCTCGAATTAGCTTCAAA
rhlATp1R TGCCGCGGATCATGAAGCTGTACAACTACCGGTATCTGACGAAGCTGCCGGAGCTCGAATTGGGGATCTT
rhlA5'2F GTGGTCGTGAAAGCGGAAT
rhlA5'2R CGGCAGCTTCGTCAGATAC
rhlA3'3F GACCAGATCCTGTCGATGC
rhlA3'3R CTCGATCAGCGTCATCAGC
  1. 1 Restriction sites designed into the primers are underlined.
  2. 2 Primers are constructed upward of the consensus sequence of the two promoters.