Skip to main content

Table 1 Primers used in these study (5' to 3' sequence)

From: Pseudomonas aeruginosa vesicles associate with and are internalized by human lung epithelial cells

  PA2939
expression forward TTACCGGAATTCATGAGCAACAAGAACA
expression reverse AACGGCAAGCTTTTACTTGATGAAGTCG
KO up forward TGTAACTAGTATGGTCAGCACATGTTGCA
KO up reverse GCCAGGGATGCGGCGGAATTCGAGAGGGCGAGGGCG
KO down forward CGCCCTCGCCCTCTCGAATTCCGCCGCATCCCTGGC
KO down reverse CTGACCTCGAGTTACTTGATGAAGTCGTGAC
  Tet R cassette from pACYC184
EcoRI Tet forward GGTTATGAATTCGGTAGCTCAGAGAACCCTTCG
EcoRI Tet reverse GTGTTAGAATTCGATATGTTCTGCCAAGGGTT
Xho Tet forward CCGGCTCGAGGGTAGCTCAGAGAACCTTCG
Xho Tet reverse CCGGCTCGAGGATATGTTCTGCCAAGGGTT