Skip to main content

Advertisement

Table 3 Primers used to map Tn4371-like ICEs

From: Novel Tn4371-ICE like element in Ralstonia pickettiiand Genome mining for comparative elements

Genes Size (bp) Primers Tm(°C) R. pickettii12J Position Accession no.
     Start Stop  
CirIm ~220 RE1 GCATGGAAGACTTGACAG LE1 GAGCTTGAGTTTTGCCACG 54 N\A N\A FM244490
int 1035 intFor1 TTTCATTTCACCATGACTCCAG intRev1 GAGAGCAGTCGATAGGCTTCC 61.7 2715201 2716235 FM244486
RepA, ParA ParB 1657 RepAF GAGACTACCAGCGCCTCAAG RepAR ACGTGTTCATGAGGACTTCTCC 55 2734598 2736255 FM244487
traG 1483 traGF GTTCGAGTGGTGGTTCTTCTTC traGR GAAATTGCTGTCCGCGTAGTAG 61 2757179 2758661 FM244488
trbI 1597 trbIF AACTGACCATGAGCCAGGAC trbIR AAAGCTCCTCAAAAGCGAAAG 62 2767516 2769113 FM244489