Skip to main content

Table 3 Primers used to map Tn4371-like ICEs

From: Novel Tn4371-ICE like element in Ralstonia pickettiiand Genome mining for comparative elements

Genes Size (bp) Primers Tm(°C) R. pickettii12J
Position
Accession no.
     Start Stop  
CirIm ~220 RE1 GCATGGAAGACTTGACAG
LE1 GAGCTTGAGTTTTGCCACG
54 N\A N\A FM244490
int 1035 intFor1 TTTCATTTCACCATGACTCCAG
intRev1 GAGAGCAGTCGATAGGCTTCC
61.7 2715201 2716235 FM244486
RepA, ParA
ParB
1657 RepAF GAGACTACCAGCGCCTCAAG
RepAR ACGTGTTCATGAGGACTTCTCC
55 2734598 2736255 FM244487
traG 1483 traGF GTTCGAGTGGTGGTTCTTCTTC
traGR GAAATTGCTGTCCGCGTAGTAG
61 2757179 2758661 FM244488
trbI 1597 trbIF AACTGACCATGAGCCAGGAC
trbIR AAAGCTCCTCAAAAGCGAAAG
62 2767516 2769113 FM244489