Skip to main content

Advertisement

Table 3 Primers used in these studies

From: Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

Primer Name Primer Sequence
NP1 AAAGGATCCCATGAACGCGGATTGCAGACG
NP2 GGGGGATCCAGAAGATACCATACGCCTCT
S1 GAGATGGGTAAAATCCGGGT
S2 CGAACCGGATGCCGTAGAA
dwnstrm-F AAAATGTACAATTTGCCGGGCGGCAGCCTGC
dwnstrm-R AAAATGTACAGGCGTTATCTCGCTCCCGGCG
Omega-ABC TCAGATGGCGCGCCTGTACATCGATGGTGATTGATTGACGAAGCTTTATGC
NfsB-BsmI-3F GTTTAGGGCGCATTCAAGAACCGCAAATCGTGCCGGC
NfsB-BsmI-2R GCGGTTCTTGAATGCGGATAGAACCTGCTCTTTGCTTAA