Skip to main content

Table 1 Oligonucleotide primer pairs and PCR running conditions used in this study

From: Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing

Primer Sequence 5' to 3' Targeted site Amplicon size (bp) Reference
Saka 1a ACAGGGAGCAGCTTGCTGCc V1g 952 Hassan et al., [45]
Zpx F GAAAGCGTATAAGCGCGATTCd zpx 94 Kothary et al., [13]
BAM122 AWATCTATGACGCGCAGAACCGe zpx 350 Kothary et al., [13]
EsgluAf TGAAAGCAATCGACAAGAAGf gluA 1680 Lehner et al., [3]
EsgluBf TGAGTGAAGCACCGACGCAGf gluB 1720 Lehner et al., [47]
ESSF GGATTTAACCGTGAACTTTTCCi ompA 469 Nair and Venkitanarayanan [46]
  1. a&b Running conditions; 94°C for 10 min; 30 cycles of 94°C for 30 sec each; 57°C for 1 min; 72°C for 1 min; a final extension period of 5 min at 72°C.
  2. c Running conditions; 95°C for 4 min; 30 cycles of 95°C for 60 sec each; 50°C for 1 min; 72°C for 90 sec; final extension period of 4 min at 72°C.
  3. d&e Running conditions; The hot start polymerase was activated by incubation for 15 min at 95°C; followed by 35 cycles of 1 min at 95°C; 62°C for zpx primers (50.5°C was used for 8 isolates) or 50°C for BAM primers for 1 min; 72°C for 1 min; final extension of 10 min at 72°C for zpx and 7 min for BAM primers.
  4. f Running conditions were as described by Lehner et al. [3, 47]; The hot start polymerase was activated by incubation for 15 min at 95°C; followed by 30 cycles of 30 s at 94°C; 56°C (gluA) or 58°C (gluB) for 1 min; 72°C for 1.5 min; final extension period of 5 min at 72°C.
  5. g&h: Variable regions of the 16S rRNA gene.
  6. i Running conditions: 94°C for 2 min; 30 cycles 94°C for 15 sec each; 60°C for 15 sec; 72°C for 30 sec; final extension period of 5 min at 72°C.