Skip to main content

Table 2 VNTR loci and primers used for their amplification a

From: MLVA distribution characteristics of Yersinia pestisin China and the correlation analysis

Locus Core sequence Repeat unit size (bp) Forward and Reverse primer (5'-3')
M76 TGTGGTGATCTAAGCGCAACACA
GTTAAAAACAGATTTTAA
41 F:GCGGCCTGATAAGGGATATTGGAAGC
R:GGCGAAATTCATTAAAGAGGATCCTGACAC
M73 AATGCCTATTCCTCTGACAGAAT
CCGTATC
30 F:GCTTTCTGGCAATGCGATAGTTAGGCATCTC
R:GTTAATTTAACTCAATATTGTCGCTATGGT
M72 TTCATAGCTTCTATTATAGAGA 22 F:GCGACACGCCCTTTCAATGAGATACAC
R:GTAGATCACCGCTAAATGCGAAGGTCCAC
M66 ATTTACGGTATAGCTACTGA 20 F:GAGATGGATTAACCAGATGTCTTAAAAACTATCGTAAC
R:GCGAATCGGCGGCCCAAAC
M61 TTTCAAGCTGAATGTGTG 18 F:GCGCCACAATTAGGGCAACTGC
R:GCCGCTTTAATGGTTTGTGAAATGAC
ms01 TGCAGTGAAAAGGTTAAC 18 F:CTAAGCACAATTGTTATGCTGAACC
R:TACTGAATCTGCTTCATTGTTCAAA
M59 TTACTGATATGGGCTAG 17 F:GCTTAGCCGCCAGAAAAGGTGAGTTGGC
R:GATAATGGCGGTAGCCGGAATCTGATAATCATC
M58 CATAGATAGCTAAACAA 17 F:GCGATAACCCACATTATCACAATAACCAACAC
R:GCTGATGGAACCGGTATGCTGAATTTGC
M55 TATTGAGGAATGAATG 16 F:GTCATGGGTGATGCTGTTGCTCTCATTTTATAGTTGTAGTGA
R:GCCTTAATGGTTGAATGCGCGAATGAGTCAGATAAC
M54 TTTATGGTTCAACTTG 16 F:GTATGCTTAGCGCCAGTGATAACGAGTC
R:GATCGCGTCATCGGGGTTTGTC
M52 GTTGTAAAACCAGAT 15 F:GTGGCCTAACCCGTTTTACCGGTGTAGC
R:GCGGTTTTGTCAATCACGAATCAGGACTC
M51 TTATCACGGTTGGTG 15 F:GCAACCCGCTGAAGTTGTAAAAACCGAC
R:GCGTTGATCTTCGCGGCCTTCAC
M49 TTGTAACGACTGAT 14 F:GTAATACTTACGCCTTGGCAGCAGTGTTCACGAC
R:GTGGGGTGTTCTACGGTGGATTGTTTTTAGGC
M37 ACTATCACCG 10 F:GCCACAGGAAGAGGACATTTCAGAGAAAAC
R:GTTGCTAAAACGATACCGCTACGATCAGC
  1. aAll the primers used here were described in reference 12, except ms01, which was from reference 17.