Skip to main content

Table 1 PCR primers used for gene amplification and sequencing.

From: Genotypic comparison of Pantoea agglomeransplant and clinical strains

Gene(s) Primer name Sequence (5'-3') Size (bp) Tm (°C) Reference
gyrB gyr-320 TAARTTYGAYGAYAACTCYTAYAAAGT 970 50 [63]
  rgyr-1260 CMCCYTCCACCARGTAMAGTTC    [63]
hrcN hrcN-4r CGAGCAGGAYTCGATGAACG 250 50 [57]
  hrcN-5rR CCGGWYTGGTATTCACCCAG    [57]
29-kbp GI mutS-rev CGCCATCGGGATCGGTTCGCC 554 60 This work
  narL-rev GCCGTCTGGGCGCTGCAGAACG    This work
paaABC paaA-fw CTCTTGCCAAAATGGATGGT 2398 55 This work
  paaC-rev TTGCAAATTCTGCACTCTCG    This work
pagRI pagR-fw GTGAAGGATACYTACTACAACG 1206-29 55 This work
  pagI-rev CGAATGCATTGACGGCATGG    This work
rrs 16S-8F AGAGTTTGATCCTGGCTCAG 1503 48 [64]
  16S-533R TTACCGCGGCTGCTGGCAC    [64]
  16S-609R ACTACYVGGGTATCTAAKCC    [65]
  16S-1492R ACGGTTACCTTGTTACGACTT    [64]
  1. Tm = annealing temperature