Skip to main content

Advertisement

Table 4 Primers used for real-time PCR in this study

From: Use of in vivo-induced antigen technology (IVIAT) for the identification of Streptococcus suis serotype 2 in vivo-induced bacterial protein antigens

gene Sequences of primers (5' to 3') Amplicon size (bp)
cwh TGGTAAATGCCCCATCTAGTC 137
  GGCTGTAACACCAATAATTTCC  
hprk GAAACCCCTGTTGTCATAGTGG 126
  CAATTCTCCCGATAGACGACTG  
ss-1616 ACAGGGAATAAGCATCAGCG 119
  ATGTAGTTACGCTCCGCCTT  
ysirk GCACTTTTATTGCCACGGATT 160
  CAGCACCTTGTTGTCTCGGA  
gapdh TTGGAAGCTACAGGTTTCTTTG 98
  TTACCACCAGGAGCAGTGACA  
ss-1955 ATCAGGTTCTAACATTGTTGCG 122
  TAACGCCCCCCTCTAACAAG  
srt GGTCGACGAAGTGTCATTGC 123
  ATACGTCAGCGTCCTCCCAC  
nlpa CTGCAACCTGGTCACCAAATAC 129
  ACCCCGGAAAAGTTACGTATGA  
sdh TAGAAGTCCCTTGTGTCAGACG 134
  AGATCCCACTTGGTACATAGCG  
ss-1298 TGGATATCGACAGCAAGGAG 156
  CATAGTCGCCCAAATAGAGC  
trag TCGTGACTTGATGACGGCTG 167
  GATAATGCCACCAGCGTTCA